Pandemic profiteer @thermofisher is trying to monopolize the shortcut fast PCR test for the B117 #SARSCoV2 variant—& arrogantly chest thumping.
The truth? They found it by dumb luck & now hoarding & refusing to help scientists.
Let’s use hashtag: #thermofisherpandemicprofiteer https://twitter.com/drericding/status/1344887673190817792
The truth? They found it by dumb luck & now hoarding & refusing to help scientists.
Let’s use hashtag: #thermofisherpandemicprofiteer https://twitter.com/drericding/status/1344887673190817792
2) gene sequencing for finding the mutated virus is much slower and more expensive. But we need to test likely hundreds of thousands or millions to track down the new B117 variant. UK
stumbled upon a short cut when it realized a special PCR can find mutated signal!
stumbled upon a short cut when it realized a special PCR can find mutated signal!
3) This special shortcut PCR test is called the Taqpath- and made by @thermofisher. They refuse to release the primer probe sequence to this shortcut test that can quickly find the 69-70 deletion of new B117 variant with the “S gene dropout” signal. @JoeBiden should invoke DPA.
4) Using Defense Production Act would force the formula of this TaqPath test from @thermofisher. But that is still weeks away.
We actually only discovered the Colorado B117 variant case because of this “S gene dropout” PCR test.
Hence lives being endangered by its withholding.
We actually only discovered the Colorado B117 variant case because of this “S gene dropout” PCR test.
Hence lives being endangered by its withholding.
5) How easy is it? The genetic sequence code can literally fit inside one line of a tweet: @K_G_Andersen thinks it’s this genetic sequence fragment code for the primer probe. But @thermofisher won’t confirm or share this **literally one line** of code!
TGGAAAAGAAAGGTAAGAACAAGTCC
TGGAAAAGAAAGGTAAGAACAAGTCC
6) If we had the sequence, we can do dense mapping like this. But @thermofisher refuses to share for betterment of mankind. And remember they didn’t even design it for this, they found it by dumb luck accident. #thermofisherpandemicprofiteer https://twitter.com/drericding/status/1341378634955841537
7) To be clear, @thermofisher did not “design” the TaqPath PCR test primers to the B117 variant. As @kakape points out, it was a “fortunate coincidence” it picked up the 69-70 deletion in the variant. Dumb luck basically. #thermofisherpandemicprofiteer
https://www.sciencemag.org/news/2020/12/mutant-coronavirus-united-kingdom-sets-alarms-its-importance-remains-unclear
https://www.sciencemag.org/news/2020/12/mutant-coronavirus-united-kingdom-sets-alarms-its-importance-remains-unclear
Read on Twitter